Molecular Genetics Exercise

Miguel Ángel Pollino

Biology Teacher

«In genetics, changes that alter the nucleotide sequence of DNA are called genetic mutations, molecular mutations or point mutations. These mutations in the DNA sequence can lead to amino acid substitution in the resulting proteins. "A change in a single amino acid may not be important if it is conservative and occurs outside the active site of the protein."

Miguel Ángel Pollino

Biology Teacher

«In genetics, changes that alter the nucleotide sequence of DNA are called genetic mutations, molecular mutations or point mutations. These mutations in the DNA sequence can lead to amino acid substitution in the resulting proteins. "A change in a single amino acid may not be important if it is conservative and occurs outside the active site of the protein."

DNA Mutations Exercise

Given the following DNA sequence, answer the questions:

5'…GACTTCAAATTTGCTAACCGCAGAGTTTTAT…3′

a) What would be its messenger RNA sequence?

b) What would be the chain of amino acids resulting in the translation process?

c) Define mutation. What types of mutation exist according to their origin?

d) Suppose that in position 3 of the DNA chain (marked in red) a mutation occurs that produces the change of cytosine for adenine. What consequences could it have for the body?

e) Suppose that in position 9 of the DNA strand (marked in blue) a mutation occurs that produces the change of adenine to guanine. What consequences could it have for the body?

f) Indicate what would happen if a thymine is inserted between positions 8 and 9 of the DNA chain (marked in the sequence with an arrow). What type of mutation is it? What kind of consequences does this type of mutation usually have?

Replies

a) For the messenger RNA sequence, the complementary DNA sequence must be transcribed and the thymines (T) replaced with uracils (U). Since the DNA sequence you provided is: 5'…GACTTCAAATTTGCTAACCGCAGAGTTTTAT…3′

The messenger RNA sequence would be the complementary strand in the 5′ to 3′ direction, replacing T with U, which would be: 3'…CUGAAGUUUAAACGAUUGGCGUCUCAAAAUA…5′

But, since messenger RNA is read in the same direction as the coding DNA strand (5′ to 3′), the correct sequence would be the reverse of the strand I provided, changing the Ts to U, which gives us : 5'…CUUGAAUUUAAACGAUUGGCGUCUCAAAAA…3′

b) The chain of amino acids resulting in the translation process is determined by translating the messenger RNA into triplets or codons. Each triplet corresponds to a specific amino acid. However, to provide the exact amino acid chain, we would need to translate the entire sequence into codons and consult a codon table.

c) Mutation is a change in the DNA sequence. The types of mutations depending on their origin can be:

  • Spontaneous mutations: occur without an identifiable external cause.
  • Induced mutations: These are the result of exposure to external factors, such as radiation or chemical mutagenic agents.

d) If at position 3 of the DNA strand, cytosine is changed to adenine, this would result in a point mutation called a transition. The consequences for the organism can range from none (if the mutation is silent or occurs in a non-coding region) to detrimental effects if it affects a crucial gene or disrupts an important regulatory sequence.

e) A mutation at position 9 of the DNA strand that changes an adenine to a guanine would also be a transition. The consequences of this mutation would be similar to those described in the previous answer, depending on whether the mutation alters the amino acid sequence of a protein and whether that protein is essential for some important function in the organism.

f) If a thymine is inserted between positions 8 and 9 of the DNA strand, this would result in an insertion mutation. This type of mutation can cause a frameshift, which changes all subsequent codons and usually has serious effects, as it can completely alter the amino acid sequence of the resulting protein, often resulting in a non-generic protein. functional.

It is important to remember that for accurate translation of the DNA sequence to amino acids, a codon table must be used and the open reading frame from which the sequence is translated must be taken into account.

Test exam on Molecular Genetics

1. What molecule is responsible for carrying genetic information from the nucleus to the cytoplasm?

a) ribosomal DNA
b) messenger RNA (mRNA)
c) Protein
d) transfer RNA (tRNA)

2. What process describes the synthesis of RNA from DNA?

a) Replication
b) Transduction
c) Transcription
d) Translation

3. During DNA replication, what enzyme is responsible for adding new nucleotides to the forming DNA strand?

a) Ligase
b) RNA polymerase
c) DNA helicase
d) DNA polymerase

4. Which of the following elements is not part of a DNA nucleotide?

a) Phosphate group
b) Deoxyribose sugar
c) Nitrogen base
d) Carboxyl group

5. What type of genetic mutation involves the exchange of a single nitrogenous base for another?

a) Frameshift mutation
b) Deletion
c) Insertion
d) Point mutation

If you want to try more tests, you can take the Biology Level Test to find out if you are prepared for exams and tests.

Test answers: 1b, 2c, 3d, 4d, 5d

Latest Posts

Related Post

Subjects

Subscribe to our newsletter and don't miss a thing!

The courses for the PCE 2027 exams have just started, so you don't fall behind...